View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16741_low_78 (Length: 207)

Name: NF16741_low_78
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16741_low_78
NF16741_low_78
[»] chr2 (1 HSPs)
chr2 (108-147)||(5461181-5461220)


Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 108 - 147
Target Start/End: Complemental strand, 5461220 - 5461181
Alignment:
108 taataatttggaataataaattaattgaatgtaatcacat 147  Q
    ||||||||||  ||||||||||||||||||||||||||||    
5461220 taataatttgagataataaattaattgaatgtaatcacat 5461181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University