View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16742_high_16 (Length: 334)
Name: NF16742_high_16
Description: NF16742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16742_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 14 - 319
Target Start/End: Complemental strand, 30818361 - 30818056
Alignment:
| Q |
14 |
gaagattatgagaggaagtttctatggttcatgggatttgaatgctactaatgatgcaaatttaggttatatgaatgatacttcttattactctgtgact |
113 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30818361 |
gaagatcatgagaggaattttctatggttcatgggatttgaatgctactaatgatgcaaatttaggttatatgaatgatacttcttattactctgtgact |
30818262 |
T |
 |
| Q |
114 |
tgggagaaggaagttggtaatggaagttggatttttcaccatgtgttgaagacttcttctaaatatccttggttaatgctttatcttagatcagatgcta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30818261 |
tgggagaaggaagttggtaatggaagttggatttttcaccatgtgttgaagacttcttctaaatatccttggttaatgctttatcttagatcagatgcta |
30818162 |
T |
 |
| Q |
214 |
ctacaggattctctggtggttaccattatgaaactagaggcatgacaaaaattgtaccaaagtcaccacattttaaggtaaggttcacacttgatatcaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30818161 |
ctacaggattctctggtggttaccattatgaaactagaggcatgacaaaaattgtaccaaagtcaccacattttaaggtaagattcacacttgatatcaa |
30818062 |
T |
 |
| Q |
314 |
gaaagg |
319 |
Q |
| |
|
|||||| |
|
|
| T |
30818061 |
gaaagg |
30818056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University