View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16742_high_25 (Length: 228)

Name: NF16742_high_25
Description: NF16742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16742_high_25
NF16742_high_25
[»] chr3 (1 HSPs)
chr3 (19-125)||(54207595-54207701)


Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 19 - 125
Target Start/End: Original strand, 54207595 - 54207701
Alignment:
19 aaatgcttctgatttcttagtctgttactatcggagattgagaataatgggtagacgccatggatgggaactcccttttcacacttttcaggtacctcct 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54207595 aaatgcttctgatttcttagtctgttactatcggagattgagaataatgggtagacgccatggatgggaactcccttttcacacttttcaggtacctcct 54207694  T
119 gtactac 125  Q
    |||||||    
54207695 gtactac 54207701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University