View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16742_low_19 (Length: 292)
Name: NF16742_low_19
Description: NF16742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16742_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 37468504 - 37468747
Alignment:
| Q |
1 |
aagaaggaggagagttccggaacgaagaataacgtggttgcgtcgagttattgggggatttcgaggccaaagattatgagagaggatggaacagagtggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37468504 |
aagaaggaggagagttccggaacgaagaataacgtggttgcgtcgagttattgggggatttcgaggccaaagattatgagagaggatggaactgagtggc |
37468603 |
T |
|
| Q |
101 |
cttggaactgcttcatggtaacgattttctgaattgaaga-nnnnnnnnnngcattcgtttgttttttcgctaattcatgatttctataagtggaatttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37468604 |
cttggaactgcttcatggtaacgattttctgaattgaagatttttttttttgcattcgtttg-tttttcgctaattcatgatttctataagtggaatttg |
37468702 |
T |
|
| Q |
200 |
acttatgagacgagatttcgttgttaattgtagccatgggagactt |
245 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37468703 |
acttatgagacgaga-ttcgttgttaattgtagccatgggagactt |
37468747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 29935568 - 29935532
Alignment:
| Q |
85 |
gatggaacagagtggccttggaactgcttcatggtaa |
121 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
29935568 |
gatggaactgagtggccatggaactgcttcatggtaa |
29935532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University