View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16742_low_20 (Length: 260)
Name: NF16742_low_20
Description: NF16742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16742_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 15821989 - 15821764
Alignment:
| Q |
19 |
taaaaaagctagcttcttgcattagggagagtttggggtcttgattttgtgaaatatgccttcttt--ctctctctctttcttttacttaaataccttgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15821989 |
taaaaaagctagcttcttgcattagggagagtttggggtcttgattttgtgaaatatgccttctttttctctctctctttcttttacttaaataccttgg |
15821890 |
T |
|
| Q |
117 |
ccaactaccagttcatatcttgctggaattttttagcatgaaccatatttagtcttttggctactccatttgtactatataatcttaatagctgcatcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15821889 |
ccaactaccagttcatatcttgctggaattttttagcatgaaccatatttagtcttttggctactccatttgtactatataatcttaataactgcatcat |
15821790 |
T |
|
| Q |
217 |
tttttagaaagttcttctgttgcttc |
242 |
Q |
| |
|
| ||||||||||||||| |||||||| |
|
|
| T |
15821789 |
tctttagaaagttcttcagttgcttc |
15821764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University