View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16742_low_21 (Length: 257)
Name: NF16742_low_21
Description: NF16742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16742_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 47350560 - 47350802
Alignment:
| Q |
1 |
aggattccagttttttatattacttcatcaagataaaaaatatttaactaattagtaaaaggattattataagataata-ataatatgcacataaaccaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| | |||| || |||||||||| |
|
|
| T |
47350560 |
aggattccagttttttatattacttcatcaagataaaaaataattaactaattagtaaaaggattat---aagataacacataaaat---cataaaccaa |
47350653 |
T |
 |
| Q |
100 |
tttccctcgttggttttgtgatgtgagtttcccccaatcaacaagcaaaccatgtccatgctcgtgtagtttaattttcagttaggagtgaatcttttct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350654 |
tttccctcgttggttttgtgatgtgagtttcccccaatcaacaagcaaaccatgtccatgctcgtgtagtttaattttcagttaggagtgaatcttttct |
47350753 |
T |
 |
| Q |
200 |
tttattgctaaaatgcatgtgacacatttttcaggcagtattatctacc |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
47350754 |
tttattgctaaaatgcatgtgacgcatttttcagacattattatctacc |
47350802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University