View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16742_low_23 (Length: 254)
Name: NF16742_low_23
Description: NF16742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16742_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 24881185 - 24881391
Alignment:
| Q |
15 |
attattctattttgtgtttgaagatttttcattccttgttagacttaactaccgactcatatgataaggattttgataactttaatccaaaaatagtatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24881185 |
attattctattttgtgtttgaagatttttcattccttgttagacttaactaccgactcatatgataaggactttgataactttaatccaaaaatagtatg |
24881284 |
T |
 |
| Q |
115 |
attcatgttaggaggcaggagctacgactatggagtattattgaatatacattgattttaccaaaaccactaactataagacatcaactgaaaaccttca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24881285 |
attcatgttaggaggcaggagctacgactatggagtattttttaatatacattgattttaccaaaaccactaactataagacatcaactgaaaaccttct |
24881384 |
T |
 |
| Q |
215 |
taaagaa |
221 |
Q |
| |
|
||||||| |
|
|
| T |
24881385 |
taaagaa |
24881391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University