View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16742_low_26 (Length: 228)
Name: NF16742_low_26
Description: NF16742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16742_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 19 - 125
Target Start/End: Original strand, 54207595 - 54207701
Alignment:
| Q |
19 |
aaatgcttctgatttcttagtctgttactatcggagattgagaataatgggtagacgccatggatgggaactcccttttcacacttttcaggtacctcct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54207595 |
aaatgcttctgatttcttagtctgttactatcggagattgagaataatgggtagacgccatggatgggaactcccttttcacacttttcaggtacctcct |
54207694 |
T |
|
| Q |
119 |
gtactac |
125 |
Q |
| |
|
||||||| |
|
|
| T |
54207695 |
gtactac |
54207701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University