View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16744_high_4 (Length: 358)
Name: NF16744_high_4
Description: NF16744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16744_high_4 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 193 - 358
Target Start/End: Original strand, 45360203 - 45360371
Alignment:
| Q |
193 |
ctcttgcggcaacgcaaccatcggaaattatttgagattgataaggtattatgttttgtaggc---tgaaactggtatcttacagggaatatgctatttg |
289 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
45360203 |
ctcttgccgcaacgcaaccatcggaaattatttgagattgataaggtattatgttttgtaggccgctgaaactggtaccttacagggaatatgctatttg |
45360302 |
T |
 |
| Q |
290 |
tgtctatcggtcaatgcatttataaggtgagtaacaaaatccttcattgtttcttcttttttcattcat |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45360303 |
tgtctatcggtcaatgcatttataaggtgagtaacaaaatccttcattgtttcttcttttttcattcat |
45360371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 31 - 124
Target Start/End: Original strand, 45360041 - 45360134
Alignment:
| Q |
31 |
ttatcttttggatattgatgaactgctgcaactgctttgtatatggatgattgtatagttaattaaattttcacaattttggaacatatactga |
124 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45360041 |
ttatcttttggatatcgatgaactgctgcaactgctttgtatatggatgattgtataattaattaaattttcacaattttggaacatatactga |
45360134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University