View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16744_high_6 (Length: 239)
Name: NF16744_high_6
Description: NF16744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16744_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 229
Target Start/End: Complemental strand, 11025830 - 11025627
Alignment:
| Q |
19 |
gatacaccactctttatatctcccattgtgtccagtgtccgagtccaagtctcagggattacctattccttcccttgttttggtaattcaatagacatct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11025830 |
gatacaccactctttatatctcccattgtgtcc-------gagtccaagtctcagggattacctattccttcccttgttttggtaattcaatagacatct |
11025738 |
T |
|
| Q |
119 |
gtcattgatcagtcagctccatcttctcctacgaagcctcctcatcctcttcccccgcaaacttatctgtgccgtccatgcttcccttctgccccggtct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11025737 |
gtcattgatcagtcagctccatcttctcctacgaagcctcctcatcctcttcccccgcaaacttatctgtgccgtccatgcttcccttctgccccggtct |
11025638 |
T |
|
| Q |
219 |
cctttgctact |
229 |
Q |
| |
|
||||| ||||| |
|
|
| T |
11025637 |
ccttttctact |
11025627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University