View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16744_low_10 (Length: 236)
Name: NF16744_low_10
Description: NF16744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16744_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 40011081 - 40011290
Alignment:
| Q |
13 |
gattatactggcggataaggcaatgagtgatttgagaaacactaacttaaggctgaagaaaactatcaccgaggtaactgacatgattaattgcactctc |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40011081 |
gattatacaggcggataaggcaatgagtgatttgagaaacactaacttaaggctgaagaaaactatcactgaggtaactgacatgattaattgcactctc |
40011180 |
T |
|
| Q |
113 |
ctttgtgttaaaatttgtaagcttctattgaaatgcaattttgtttgatcttcagctgaggtctagtcgaaatttctgcatcgacatcattctattatgt |
212 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011181 |
ctctgtgttaaaatttgaaagcttctattgaaatgcaattttgtttgatcttcagctaaggtctagtcgaaatttctgcatcgacatcattctattatgt |
40011280 |
T |
|
| Q |
213 |
gttcttcttg |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
40011281 |
gttcttcttg |
40011290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University