View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16744_low_5 (Length: 376)
Name: NF16744_low_5
Description: NF16744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16744_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 4e-54; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 31016342 - 31016513
Alignment:
| Q |
17 |
atttcagtcccttcacctttttgagcaactctggtgctcataattttctccgtactctacgattcccacctaattgtatgtaaatgtagaaaaatatgat |
116 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31016342 |
atttcaatcccttcacttttttgagcaactctggtgctcataattttctccgtactctacgattcccacctaattgtatgtaaatgtagaaaaata---- |
31016437 |
T |
 |
| Q |
117 |
gtggcaactctggagcacttgggtgcctttgactaaaaaccgatgtggcaatcaattgttatttccatgttacctttaaactt |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
31016438 |
-----aa--ggggagcacttgggtgcctttgactaataaccgatgtggcaaccaattgttatttctatgttaccttcaaactt |
31016513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 233 - 363
Target Start/End: Original strand, 31016547 - 31016683
Alignment:
| Q |
233 |
taacactagagttgaaatctccacattccaaaccaaaatcatccat----atactttttgttttagatagagagat--ttgaagaatcataatcgtcttc |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
31016547 |
taacactagagttgaaatctccacattccaaaccaaaatcatccatgtatatactttttgttttagatagagagatatttgaagaatcatattcgtcttc |
31016646 |
T |
 |
| Q |
327 |
atcagtttgattcatcgttttctttaattttatgttc |
363 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31016647 |
atcagtttgattcatcattctctttaattttatgttc |
31016683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 199
Target Start/End: Original strand, 31012008 - 31012049
Alignment:
| Q |
158 |
gatgtggcaatcaattgttatttccatgttacctttaaactt |
199 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
31012008 |
gatgtggcaagcaattgttatttctatgttaccttcaaactt |
31012049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University