View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16745_low_13 (Length: 253)
Name: NF16745_low_13
Description: NF16745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16745_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 9811811 - 9811609
Alignment:
| Q |
19 |
agtattgatgatttatctgttacgatacgattttctgataccataagttttttgtgtgtgcagattgttggtagttatatacatctttgaggaatttgtg |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9811811 |
agtattgatgatttatctgttacaatacgattttctgataccataagttttttgtgtgtgcagattgttggtagttatatacatctttgaggaatttgtg |
9811712 |
T |
|
| Q |
119 |
ctggttagggttgttttctgcttatacttgaaaggaagaaacatacagtgtagctgcaatggttgaagatgattatcttcctccttggtttaggtatata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9811711 |
ctggttagggttgttttctgcttatacttgaaaggaagaaacatacagtgtagctgcaatggttgaagatgattatcttcctccttggtttaggtatata |
9811612 |
T |
|
| Q |
219 |
tgc |
221 |
Q |
| |
|
||| |
|
|
| T |
9811611 |
tgc |
9811609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University