View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16745_low_14 (Length: 220)
Name: NF16745_low_14
Description: NF16745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16745_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 37386620 - 37386811
Alignment:
| Q |
14 |
caattaattcgatatatcttcccatcacttccatcattaatttaccagagcttattgaccaatataacttggttaaatgtttgaaatattaatggaatct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37386620 |
caattaattcgatatatcttcccatcacttccatcattaatttaccagagctcattgaccaatataacttggttaaatgtttgaaatattaatggaatct |
37386719 |
T |
 |
| Q |
114 |
tggtttttaggtgaatgagttgttgggaatcataattatgtttttgagagcctagctagcctatacggtgagagtaatgtgcttttaaagta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37386720 |
tggtttttaggtgaatgagttgttgggaatcataattatgtttttgagagcctagctagcctatacggtgagagtaatgtgcttttaaagta |
37386811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University