View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16745_low_4 (Length: 410)
Name: NF16745_low_4
Description: NF16745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16745_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 9e-43; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 13 - 113
Target Start/End: Original strand, 34045334 - 34045434
Alignment:
| Q |
13 |
ttttgtattttatcggggatagtttagtcttatatcctcaaggtatctagctcaaatttcattggagatggttataaaatggttattagtacccattgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34045334 |
ttttgtattttatcggggatagtttagtcttatatcctcaaggtatatagttcaaatttcatcggagatggttataaaatggttattagtacccattgaa |
34045433 |
T |
|
| Q |
113 |
t |
113 |
Q |
| |
|
| |
|
|
| T |
34045434 |
t |
34045434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 137 - 184
Target Start/End: Original strand, 34045449 - 34045496
Alignment:
| Q |
137 |
gttctttcactctcgtgttatttccatggtgagattaaagctcctttg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34045449 |
gttctttcactctcgtgttatttccatggtgagattaaagctcctttg |
34045496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 217
Target Start/End: Original strand, 34045714 - 34045751
Alignment:
| Q |
180 |
ctttgaaatgaatggaattgaactgaagaagaaataaa |
217 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
34045714 |
ctttaaaattaatggaattgaactgaagaagaaataaa |
34045751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University