View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16745_low_4 (Length: 410)

Name: NF16745_low_4
Description: NF16745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16745_low_4
NF16745_low_4
[»] chr5 (3 HSPs)
chr5 (13-113)||(34045334-34045434)
chr5 (137-184)||(34045449-34045496)
chr5 (180-217)||(34045714-34045751)


Alignment Details
Target: chr5 (Bit Score: 89; Significance: 9e-43; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 13 - 113
Target Start/End: Original strand, 34045334 - 34045434
Alignment:
13 ttttgtattttatcggggatagtttagtcttatatcctcaaggtatctagctcaaatttcattggagatggttataaaatggttattagtacccattgaa 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||    
34045334 ttttgtattttatcggggatagtttagtcttatatcctcaaggtatatagttcaaatttcatcggagatggttataaaatggttattagtacccattgaa 34045433  T
113 t 113  Q
    |    
34045434 t 34045434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 137 - 184
Target Start/End: Original strand, 34045449 - 34045496
Alignment:
137 gttctttcactctcgtgttatttccatggtgagattaaagctcctttg 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
34045449 gttctttcactctcgtgttatttccatggtgagattaaagctcctttg 34045496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 217
Target Start/End: Original strand, 34045714 - 34045751
Alignment:
180 ctttgaaatgaatggaattgaactgaagaagaaataaa 217  Q
    |||| |||| ||||||||||||||||||||||||||||    
34045714 ctttaaaattaatggaattgaactgaagaagaaataaa 34045751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University