View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16745_low_6 (Length: 373)
Name: NF16745_low_6
Description: NF16745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16745_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 10 - 280
Target Start/End: Complemental strand, 38400481 - 38400205
Alignment:
| Q |
10 |
attattctgcctacatggtacgtagacactgatatagctagttaagtcaattacattacatgatagtattacaaattatttcccttttcctttgagataa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38400481 |
attattctgcctacatggtacgtagacattgatatagctagttaagtcaattacattacatgatagtattacaaattatttcccttttgctttgagataa |
38400382 |
T |
 |
| Q |
110 |
aattgaaagttggaatagtgagattgatctttatgcatgcatgcttcacactctctctttatatagctttaattatcatcatca------tcatggtaac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38400381 |
aattgaaagttggaatagtgagattgatctttatgcatgcatgcttcacactctctctttatatagctttaattatcatcatcatcatcatcatggtaac |
38400282 |
T |
 |
| Q |
204 |
catccacccatgtagttattcatgcttggccctgctgtcaccaccactgatcctggatcagcctgatatctgcataa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38400281 |
catccacccatgtagttattcatgcttggccctgctgtcaccaccactgatcctggatcagcctgatatctgcataa |
38400205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University