View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16746_low_10 (Length: 242)
Name: NF16746_low_10
Description: NF16746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16746_low_10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 52876452 - 52876674
Alignment:
| Q |
19 |
gaagtttctagtaccaacacaatttctattatcattgcaatttatgcactaaaactttaagacaaagagacaaactttggaatatattactcatattgat |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52876452 |
gaagtttctagtaccaatacaatttctattatcattgcaatttatgcactaaaactttaagacaaagagacaaactttggaatatattactcatattgat |
52876551 |
T |
|
| Q |
119 |
aattgtatgagatttaatttgttttctttaaacatgtcattaaccgactctaattgatgaaacaagacaaatccatgannnnnnnnncttttcaaaaaca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
52876552 |
aattgtatgagatttaatttgttttctttaaacatgtcattaaccgactctaattgatgaaacaaaacaaatccatga-ttttttttcttttcaaaaaca |
52876650 |
T |
|
| Q |
219 |
aaggcaaaagttgcactgattttt |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52876651 |
aaggcaaaagttgcactgattttt |
52876674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University