View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16746_low_11 (Length: 219)
Name: NF16746_low_11
Description: NF16746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16746_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 57 - 205
Target Start/End: Original strand, 17543911 - 17544059
Alignment:
| Q |
57 |
ttatatgtgtttaattatttcatttagagttgaaaacattatttacttttcaaaaatataatagaatacgccaacgaaaattgatgtagttaataagaac |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17543911 |
ttatatgtgtttaattatttcatttagagttgaaaacattatttatttttcaaaaatataataaaatacgccaacgaaaattgatgtagttaataagaac |
17544010 |
T |
 |
| Q |
157 |
tcaacctatatcttacaagcatgcgagtttcaacctttatatcaatatg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17544011 |
tcaacctatatcttacaagcatgcgagtttcaacctttatatcaatatg |
17544059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University