View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16746_low_6 (Length: 266)
Name: NF16746_low_6
Description: NF16746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16746_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 69 - 232
Target Start/End: Complemental strand, 8362059 - 8361896
Alignment:
| Q |
69 |
gtcatgttaatagaaagtttgaaattgaaggaagttaatgggcgagtaaggaatagaaaaatgtagttgaaaagattgggattcgtgtaatagttagtgt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8362059 |
gtcatgttaatagaaagtttgaaattgaaggaagttaatgggcgagtaaggaatagaaaaatgtagttgaaaagattgggattcatgtaatagttagtgt |
8361960 |
T |
 |
| Q |
169 |
tttagtgtcatatattaccattaatcatgacaaggtaacaatgtcttcaacccttttctttcct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
8361959 |
tttagtgtcatatattaccattaatcatgacaagataacaatgtcttcaatccttttctttcct |
8361896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 220 - 250
Target Start/End: Complemental strand, 8361876 - 8361846
Alignment:
| Q |
220 |
ccttttctttcctaactgcaagtaacttggt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8361876 |
ccttttctttcctaactgcaagtaacttggt |
8361846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University