View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16747_low_5 (Length: 322)
Name: NF16747_low_5
Description: NF16747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16747_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 14 - 306
Target Start/End: Original strand, 26685120 - 26685412
Alignment:
| Q |
14 |
atcagtgataaatagtccaggtttcccatatgaaaatgtaggtggaatattagccttaggctttagacaccattcatttgttgacaatgctggtctaaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26685120 |
atcagtgataaatagtccaggtttcccatatgaaaatgtaggtggaatattagccttaggctttagacaccattcatttgttgacaatgctggtctaaaa |
26685219 |
T |
 |
| Q |
114 |
tttggttcaaaattttcgtattgtcttgttgaccatttgagccacaaaaatgtttcaagctacctaacatttggaacaactcctaaagtcaaattgttga |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26685220 |
tttggttcaaaattttcctattgtcttgttgaccatttgagccacaaaaatgtttcaagctacctaacatttggaacagctcctaaagtcaaattgttga |
26685319 |
T |
 |
| Q |
214 |
gtgaaatcaaaagaacagatatgcttttgtatcaaccattttatggtgtgaatgttaccggcatctccatcgacgatcaaatgctgaaaatcc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26685320 |
gtgaaatcaaaagaacagatatgcttttgtatcaaccattttatggtgtgaatgttaccggcatctccatcgacgatcaaatgctgaaaatcc |
26685412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University