View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16747_low_6 (Length: 229)
Name: NF16747_low_6
Description: NF16747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16747_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 35015712 - 35015512
Alignment:
| Q |
14 |
aatatgttcaattgaatgtgaccacgtaaaactctatcgcacgtaacggtgcgatgaatattttgttagatgttcatataaaactattttacaccaataa |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35015712 |
aatatgttcaattgagtgtgaccacgtaaaactctatcgcacgtaacagtgcgatgaatattttgttagatgttcatataaaactattttacaccaataa |
35015613 |
T |
 |
| Q |
114 |
tgcacatctactaaaccctac-nnnnnnnaatacttttgaaacattcgaaggagatagagatagaaggagggattgtggtatggtagtagaaggaaggtg |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35015612 |
tgcacatctactaaaccctacttttttttaatacttttgaaacattcgaaggagatagagatagaaggagggattgtggtatggtagtagaaggaaggtg |
35015513 |
T |
 |
| Q |
213 |
g |
213 |
Q |
| |
|
| |
|
|
| T |
35015512 |
g |
35015512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University