View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16747_low_7 (Length: 223)
Name: NF16747_low_7
Description: NF16747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16747_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 38332205 - 38332043
Alignment:
| Q |
18 |
atttgtgtgttcctaatttttccaaaacattttgcttgtgttctcaannnnnnngttccttctacatccatgtgtaattgagactagtttgttccttcca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
38332205 |
atttgtgtgttcctaatttttccaaaacattttgcttgtgttctcaatttttttgttccttctacatccgtgtataattgagactagtttgttccttcca |
38332106 |
T |
 |
| Q |
118 |
attttcagaacaaaacccctttcgaaaggcaaatcattgcttcaattccaaaacttgttttaa |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38332105 |
attttcagaacaaaacccttttcgaaaggcaattcattgcttcaattccaaaacttgttttaa |
38332043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 38331859 - 38331817
Alignment:
| Q |
171 |
cttgttttaatcgttgtttaattagttttagtttgggtctgtg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38331859 |
cttgttttaatcgttgtttaattagttttagtttgggtctgtg |
38331817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University