View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16748_low_21 (Length: 350)
Name: NF16748_low_21
Description: NF16748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16748_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 19 - 335
Target Start/End: Complemental strand, 19782103 - 19781786
Alignment:
| Q |
19 |
aggatattagcctataaataaaacatttagcgtgtnnnnnnn-ttaagcattttgatttagattagaaaagcacgttcatatcctgaacactaaaatcct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19782103 |
aggatattagcctataaataaaacatttagcgtgtaaaaaaaattaagcattttgatttagattagaaaagcacgttcatatcctgaacactaaaatcct |
19782004 |
T |
|
| Q |
118 |
atttggtttttatgcattttcccataccctcactttccaccctaaacaaagatgtatgagataatcctaaccagttcaccagaaggtcccatgatagcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19782003 |
atttggtttttatgcattttcccataccctcactttccaccctaaacaaagatgtatgagataatcctaaccagttcaccagaaggtcccatgatagcat |
19781904 |
T |
|
| Q |
218 |
ttgatgcttccaccggtgccacggttgcgcagttcactggcagccggtcaccatgtcgtggtctcatggtgacaagccaaggattcattgcagcttccca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781903 |
ttgatgcttccaccggtgccacggttgcgctgttcactggtagccggtcaccatgtcgcggtctcatggtgacaagccaaggattcattgcagcttccca |
19781804 |
T |
|
| Q |
318 |
tgtgtcctcgaacacagg |
335 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
19781803 |
tgtgtcctcgaacacagg |
19781786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University