View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16748_low_33 (Length: 260)
Name: NF16748_low_33
Description: NF16748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16748_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 34435834 - 34435631
Alignment:
| Q |
1 |
cacacgcaccagacacaagctgacacataactactaataataattttgaaaaaa--gacgtaattaaaggcaaccacatatgtcggatccggattgtaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34435834 |
cacacgcaccagacacaagctgacacataactactaataataattttgaaaaaatagacgtaattaaaggcaaccacatatgtcagatccggattgtaaa |
34435735 |
T |
 |
| Q |
99 |
taggttgtccaatcaagatcagacagtctacattacaagctaagtattttagatctnnnnnnnccaaaatcctctttaaaatctggactgttctatcttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
34435734 |
taggttgtccaatcaagatcagacagtctagattacaagctaagtattttagatctaa-------aaaaacc-----aaaatctggactgttctatcttt |
34435647 |
T |
 |
| Q |
199 |
attgacagctgatatg |
214 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34435646 |
attgacagctgatatg |
34435631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University