View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16748_low_39 (Length: 248)
Name: NF16748_low_39
Description: NF16748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16748_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 37661189 - 37661406
Alignment:
| Q |
18 |
actcacagagtcactatccctctcaccctctcagtgcaacgtcgatagtctaattgcagctttgactagttgaaagctgcggaatttaacacagcaatga |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37661189 |
actcacacagtcactatccctctcaccctctcagtgcaatgtcgatagtctaattgcagctttgactagttgaaagctgcggaatttaacacagcaatga |
37661288 |
T |
|
| Q |
118 |
atcaagtaaccttgaaaaggaaactgaaacaataaaagttccacatgctttttaagtctatttgctgcaaaatgcnnnnnnnnnnnatatgaaatgtgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||| |
|
|
| T |
37661289 |
atcaagtaaccttgaaaaggaaactgaaacaataaaagttccacatgctttttaagtctatttggtgtaaaatgc---tttttttgatatgaaatgtgtt |
37661385 |
T |
|
| Q |
218 |
cgatcaatttcggaaattcat |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37661386 |
cgatcaatttcggaaattcat |
37661406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University