View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16748_low_42 (Length: 213)
Name: NF16748_low_42
Description: NF16748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16748_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 19781766 - 19781562
Alignment:
| Q |
1 |
tacaattggcacactccaaccgtcttccaaaacatccctctccccgaacctgtggctccactagccgccaccttggatggtgactttctctttgcaggtg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781766 |
tacaattggcacactccaacggtcttccaaaacatccctctccccgaacctgtggctccactagccgccaccttggatggtgactttctctttgcaggtg |
19781667 |
T |
|
| Q |
101 |
gcgtgtcggggagtatccactccttgtcactcccttccggagatatcatcaaaacatgcactccttactcgaaacctgtttcgagtctccatcttagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781666 |
gcgtgtcggggagtatccactccttgtcactcccttccggagatatcatcaaaacatgcactccttactcgaaacctgtttcgagtctccatcttagtga |
19781567 |
T |
|
| Q |
201 |
tgatg |
205 |
Q |
| |
|
||||| |
|
|
| T |
19781566 |
tgatg |
19781562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University