View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16748_low_7 (Length: 503)
Name: NF16748_low_7
Description: NF16748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16748_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 15 - 192
Target Start/End: Complemental strand, 5154290 - 5154113
Alignment:
| Q |
15 |
aatggttaactaacctatgattaagaggagaagtatgatggaagaacagatcgtgcagagaatagagaagtaggcagggcttagagtggtggcaacttct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5154290 |
aatggttaactaacctatgattaagaggagaagtatgatggaagaacagatcgtgcagagaatagagaagtaggcagggcttagagtggtggcaacttct |
5154191 |
T |
 |
| Q |
115 |
gccgtgagagggaaccagagtgtgcagcaagtgagtgtaagggaaaggagagagggaaacttatattttatactaata |
192 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5154190 |
gccgtgagaaggaaccagagtgtgcagcaagtgagtgtaagggaaaggagagagggaaacttatattttatactaata |
5154113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 213 - 266
Target Start/End: Complemental strand, 5153769 - 5153715
Alignment:
| Q |
213 |
atactttctgtgaatgggcttttatacttca-ttaagtcccaacttcatccgtct |
266 |
Q |
| |
|
||||||| |||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5153769 |
atactttatgtgaaggggcttttatacttcagttaagtcccaacttcatccgtct |
5153715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University