View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16749_high_4 (Length: 311)
Name: NF16749_high_4
Description: NF16749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16749_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 45673005 - 45673212
Alignment:
| Q |
18 |
gcatggagattttgttgttcattgttgatgattcctaggagaacattctcttgttcttccgcatccgcatgaagatgatcatagtcattattcaaagagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45673005 |
gcatggagattttgttgttcattgttgatgattcctaggagaacattctcttgttcttccg------catgaagatgatcatagtcattattcaaagagt |
45673098 |
T |
|
| Q |
118 |
tgaagtaattgtctttgtaactatatgtgaatggatcttgttgtgggaaaaccacagtttcaagagcc---attattattaatttgtgactaatctaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45673099 |
tgaagtaattgtctttgtaactatatgtgaatggatcttgttgtgggaaaaccacagtttcaagagccattattattattaatttgtgactaatctaaaa |
45673198 |
T |
|
| Q |
215 |
ttattgaagagagg |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45673199 |
ttattgaagagagg |
45673212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University