View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16749_low_7 (Length: 285)
Name: NF16749_low_7
Description: NF16749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16749_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 86 - 271
Target Start/End: Original strand, 41334188 - 41334373
Alignment:
| Q |
86 |
tttggttcaaagaaatccaagtgttctgtttcaaacataacaagaataaaaagacataatctgacatcttgattgaatcaccttgcttgaattagtagta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41334188 |
tttggttcaaagaaatccaagtgttctgtttcaaacataacaagaataaaaagacataatctgacatcttgattgaatcaccttgcttgaattagtagta |
41334287 |
T |
|
| Q |
186 |
gtgttttctggtgtaaatggctagacttaggacttggattgattcaaatacatcataaaataattcaacgcccataaaagtataat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41334288 |
gtgttttctggtgtaaatggctagacttaggacttggattgattcaaatacatcataaaataattcaacgcccataaaagtataat |
41334373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University