View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16750_high_15 (Length: 300)
Name: NF16750_high_15
Description: NF16750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16750_high_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 300
Target Start/End: Original strand, 26859925 - 26860210
Alignment:
| Q |
16 |
atcaaagtggctgcatcaaatacggaatctatccaaaatcaaatttctacgataggtttttcggattcacttatggaccaagagaaacttgctatgattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26859925 |
atcaaagtggctgcatcaaatacggaatctatccaaaatcaaatttctacgataggtttttcggattcacttatggaccaggagaaacttgctatgattg |
26860024 |
T |
 |
| Q |
116 |
aatttgacaaggctgtaaaatttgaggaatagttttggcaggaaaatgctaaagttaagtggcacattgagggtgatagaaatactccatattttcacaa |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26860025 |
aatttgacaaggctgttaaatttgaggaatagttttggtaggaaaatgctaaagttaagtggcacattgagggtgatagaaatactccatattttcacaa |
26860124 |
T |
 |
| Q |
216 |
aattgcaaaggtaaggtgtggtacc-nnnnnnnnttcacttctttgtcttggtgaaaatttaatcatgaattcctaacttggtgag |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26860125 |
aattgcaaaggtaaggtgtggtaccaaaacaaaattcacttctttgtcttggtgaaaatttaatcatgaattcctaacttggtgag |
26860210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 200
Target Start/End: Complemental strand, 14142552 - 14142499
Alignment:
| Q |
147 |
gttttggcaggaaaatgctaaagttaagtggcacattgagggtgatagaaatac |
200 |
Q |
| |
|
|||||||||||| || ||||||||||| ||||||| ||| |||||||| ||||| |
|
|
| T |
14142552 |
gttttggcaggagaaggctaaagttaactggcacactgatggtgataggaatac |
14142499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University