View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_high_31 (Length: 398)
Name: NF16751_high_31
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 173 - 353
Target Start/End: Original strand, 4858675 - 4858855
Alignment:
| Q |
173 |
ggcattacctggattgcaatttcaacaacctgttaaggatggtaatgaacaatctgaagttgtttcgagttgttgtgatgatgatggtagtttgtttaat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4858675 |
ggcattacctggattgcaatttcaacaacctgttaaggatggtgatgaacaatctgaagttgtttcgagttgttgtgatgatgatggtagtttgtttaat |
4858774 |
T |
 |
| Q |
273 |
tgtactttgacttctgaacaacttggattggatcaaagggcttcagttacatcttcttgggattgtggaagtggaagaagg |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4858775 |
tgtactttgacttctgaacaacttggattggatcaaagggcttcagttacatcttcttgggattgtggaagtggaagaagg |
4858855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 9 - 106
Target Start/End: Original strand, 4858511 - 4858608
Alignment:
| Q |
9 |
aggagcagagagaaagtaatggaagaagcaaggaatagtgtacctgaaaatgggaaagtgatgcatttggtgaaggcttttgagaggttacttagtat |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4858511 |
aggagaagagagaaagtaatggaagaagcaaggaatagtgtacctgaaaatgggaaagtgatgcatttggtgaaggcttttgagaggttacttagtat |
4858608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University