View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_high_57 (Length: 298)
Name: NF16751_high_57
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_high_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 243984 - 243702
Alignment:
| Q |
1 |
taaaaaagtgtgtggaatggaatatagaaaaaagttggaaattaagagggaatgtttttgtcaacctctatcataaaccaaattaaacatgactttgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
243984 |
taaaaaagtgtgtggaatggaatatagaaaaaagttggaaattaagagggaatgtttttgtcaacctctatcataaaccaaattaaacatgactttgctt |
243885 |
T |
|
| Q |
101 |
cttggcatcattgtgttgctcatatttctttgcaaattcactaatttatgagcataaacactttaattaccatattatgagcacaacatgaggagttgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
243884 |
cttggcatcattgtgttgctcatatttctttgcaaattcactaatttatgagcataaacactttaattaccatattatgagcacaacatgaggagttgag |
243785 |
T |
|
| Q |
201 |
gatcgatgagaaggttcagaagagcatgaatatgatagtaattcctaattttaatgatcaattcaatttaaggaaagaagaag |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
243784 |
gatcgatgagaaggttcagaagagcatgaatatgatagtaattcctaattttaatgatcaattcaatttaaggaaagaagaag |
243702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University