View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_high_60 (Length: 283)
Name: NF16751_high_60
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_high_60 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 148 - 283
Target Start/End: Complemental strand, 27744941 - 27744806
Alignment:
| Q |
148 |
tgttgtgtagttaaatacttaacttgtggctaagtgatttaatatcatttgtgaaagccttaagcatgggtgtttgagaagatccttggtattctctgat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27744941 |
tgttgtgtagttaaatacttaacttgtggctaagtgatttaatatcatttgtgaaagccttaagcatgggtgtttgagaagatccttggtattctctgat |
27744842 |
T |
 |
| Q |
248 |
ttggaaggtcaccataggcaagctctctttttctct |
283 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27744841 |
ttggaaggtcaccataggcatgctctctttttctct |
27744806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 27745079 - 27745013
Alignment:
| Q |
9 |
gatatgaagaatcggtttgggtgtatgcacgaggcaaattgaacaatcagtaaaaatagccataatg |
75 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27745079 |
gataagaagaatcggtctgggtgtatgcacgaggcaaattgaacaatcagtaaaagtagccataatg |
27745013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University