View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_high_85 (Length: 232)
Name: NF16751_high_85
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_high_85 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 13285538 - 13285320
Alignment:
| Q |
1 |
aacgtacactgttgttgccctatggttctggtaataaaaggtttaattttctttcaccactttgtagcagggccacttctattgtaagattcatgtcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13285538 |
aacgtacactgttgttgccctatggttctggtaataaaaggtttaattttctttcaccactttgtagcagggccacttctattgtaagattcatgtcatg |
13285439 |
T |
 |
| Q |
101 |
cttctctgccatgattttctatgcagtacgagattaatttcctttggaataacgctactcttctttctcttttactttttcttgtcgtttcaaattcagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13285438 |
cttctctgccatgattttctatgcagtacgagattaatttcctttggaataacgctactcttctttctcttttactttttcttgtcgtttcaaattcagt |
13285339 |
T |
 |
| Q |
201 |
atcaaatatgcggttggtt |
219 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
13285338 |
atcaaatatgtggttggtt |
13285320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University