View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_12 (Length: 583)
Name: NF16751_low_12
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 305 - 570
Target Start/End: Original strand, 4885073 - 4885338
Alignment:
| Q |
305 |
atattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggtggcggtgtagggagaggcat |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4885073 |
atattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggtggcggcgtagggagaggcat |
4885172 |
T |
 |
| Q |
405 |
gaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaactccgccatcttgtgttgaaggtgaagaaggtttc |
504 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4885173 |
gaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaacaccgccatcttgtgttgaaggtgaagaaggtttc |
4885272 |
T |
 |
| Q |
505 |
ttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcttct |
570 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885273 |
ttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcttct |
4885338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 93 - 245
Target Start/End: Original strand, 4884861 - 4885013
Alignment:
| Q |
93 |
caaccgttatagatgatttgttggtgactcagaaatactctccaaatgaggtctccacacagcaacacgtcctcttcttctatctctctgactacaaacc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4884861 |
caaccgttatagatgatttgttggtgactcagaaatactctccaaatgaggtctccacacagcaacacgtcctcttcttctgtctctctgactacaaacc |
4884960 |
T |
 |
| Q |
193 |
ttctcagacagaatctcagtcaagtactgatcagaagacacaaccaacgtagc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4884961 |
ttctcagacagaatctcagtcaagtactgatcagaagaaacaaccaacgtagc |
4885013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University