View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_25 (Length: 439)
Name: NF16751_low_25
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 5e-97; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 5e-97
Query Start/End: Original strand, 7 - 267
Target Start/End: Original strand, 30720597 - 30720852
Alignment:
| Q |
7 |
gtcgaagaatatatgtaacaccatcatggatgcttgaaaattagtgtattctctttacgagcaactatatacatatgcaattgtacacttcagaaaagta |
106 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||| ||||||||| |
|
|
| T |
30720597 |
gtcgacgaatttatgtaacaccatcatggatgcttgaaaattagtgtattctctttacgaggaactatatacatatgtaactgtacacttgagaaaagta |
30720696 |
T |
|
| Q |
107 |
tgaaatattaccaaaattcatgaatcatgttgaaagtcccatattgaaacccttaaagnnnnnnnctatgaaggtgtggacaaaccgtgaatattgaatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| | | | |
|
|
| T |
30720697 |
tgaaatattaccaaaattcatgaatcatgttgaaagtaccatattgaaacccttaaagaaaaaaactatgaaggtgtggacaaaccgtg-----ttatgc |
30720791 |
T |
|
| Q |
207 |
attttggtaacacaacaaaaaatataaatgaatatgctcatggtagattgaaacaatattt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30720792 |
attttggtaacacaacaaaaaatataaatgaatatgctcatggtagattgaaacaatattt |
30720852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 30720894 - 30720949
Alignment:
| Q |
367 |
caattgattacatctcaatgtcaacatcaatatgttcaatccgtgagctagaacct |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30720894 |
caattgattacatctcaatgtcaacatcaatatgttcaatccgtgagctagaacct |
30720949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 288 - 321
Target Start/End: Original strand, 30720853 - 30720886
Alignment:
| Q |
288 |
cgggttgtggttgggaagctatacacaacatgtt |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
30720853 |
cgggttgtggttgggaaactatacacaacatgtt |
30720886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University