View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_41 (Length: 373)
Name: NF16751_low_41
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 107 - 357
Target Start/End: Original strand, 3578469 - 3578723
Alignment:
| Q |
107 |
ttggatctacaaaataacaaatatgcagagcagtttaagaaagggtgagagaatataaatttaattacttggagcaaagtctttctatcaata---gctt |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3578469 |
ttggatctacaaaataacaaataggcagagcagtttaagaaagggtgagagaatataaatttaattacttggagcaaagtctttctatcaataatagctt |
3578568 |
T |
 |
| Q |
204 |
tggaatcctctttcatatgtnnnnnnntttcaactattatccttggaaatactcattggtcaagatattcctacactagtatttcattgttatctctagt |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3578569 |
tggaatcctctttcatatgtaaaaaatcttcaactattatccttggaaatactgattggtcaagatatttctacactagtatttcattgttatctctagt |
3578668 |
T |
 |
| Q |
304 |
ataaagaaagacggttttttcgaatttgatgag-tgtgtagataaaagactacat |
357 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3578669 |
ataaagaaagacggtttcttcgaatttgatgagttgtttagataaaagactacat |
3578723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University