View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_49 (Length: 346)
Name: NF16751_low_49
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 294
Target Start/End: Complemental strand, 31363735 - 31363466
Alignment:
| Q |
16 |
atgaaagtaggtagggaatgaattacataggttaagagaatttgtccccactaccaccgcctaatttaccttcattgttttccatgcatgtggattcatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31363735 |
atgaaagtaggtagggaatgaattacataggttaagagaatttgtccccactaccaccgcctaatttaccttcattgttttccatgcatgtggattcatt |
31363636 |
T |
 |
| Q |
116 |
gttttgggcaaacatagccataaaatgctttatattgctatcaatgcgccttcgttttagatatcatcaccatgaatagtctaacactaacatcttatta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31363635 |
gttttgggcaaacatagccataaaatgctttatattgctatcaatgcgccttcgttttagatatcatcaccatgaatagtctaacactaacatcttatta |
31363536 |
T |
 |
| Q |
216 |
ttcaaccccagcttttgactactggagataaactatataggctatagctagggttggttgctcttcacttaattatttt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31363535 |
ttcaaccccagcttttgactactggagataaac---------tatagctagggttggttgctcttcacttaattatttt |
31363466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University