View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_61 (Length: 310)
Name: NF16751_low_61
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 278
Target Start/End: Original strand, 14195886 - 14196146
Alignment:
| Q |
18 |
aataggatctggaatgatagttataatgatgcaatgattccaaggccttattatcattgcatatctctaaaatatttgcaatcatttatctcataaaaat |
117 |
Q |
| |
|
|||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14195886 |
aatacgatctggactgatagtaataatgatgcaatgattccaaggccttattatcattgcatatctctaaaatatttgcaatcatttatctcataaaaat |
14195985 |
T |
 |
| Q |
118 |
ccaaaaatactactttttattggcacactgaggagaacaagatagtgttgagattcacattttctatgggatcgatatttttattacgacagtaaaatca |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14195986 |
ccaaaaatactactatttattggcacactgaggagaacaaaatagtgtcgagattcacattttctgtgggatcgatatttttattacgacagtaaaatcg |
14196085 |
T |
 |
| Q |
218 |
tgcacttgcgaacatagagtttttagtattgttgtgggggacttgttgaatatcggggtga |
278 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14196086 |
tgcacttgcggtcatagagtttttagtattgttgtgggggacttgttgaaaatcggggtga |
14196146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University