View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_76 (Length: 254)
Name: NF16751_low_76
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_76 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 239
Target Start/End: Original strand, 42748703 - 42748939
Alignment:
| Q |
14 |
atgtaatgagccaacacaagaatatgaatttggtggctgaaagtgaaagttttgaagtcatattttatattgcgtggacagttacatgtgcacatttaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42748703 |
atgtaatgagccaacacaagaatatgaatttggtggctgaaagtgaaagttttgaagtcatattttataatgcgtggacagttacatgtgcacatttaat |
42748802 |
T |
|
| Q |
114 |
gaaccattgcat---tactactactactactcctgtcaagccaacaca---tcac-----aaacccaattggcacaaactttctttcaatcgagtttatg |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||| | || ||||||||||||||||||||||||||||||||| |
|
|
| T |
42748803 |
gaaccattgcattactactactactactactcctgtcaagccaacacaaacccactagtgagacaagattggcacaaactttctttcaatcgagtttatg |
42748902 |
T |
|
| Q |
203 |
ttttctcagttctcacgtgtcaagctttatgatgagt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42748903 |
ttttctcagttctcacgtgtcaagctttatgatgagt |
42748939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University