View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_80 (Length: 248)
Name: NF16751_low_80
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_80 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 5 - 203
Target Start/End: Complemental strand, 44580489 - 44580279
Alignment:
| Q |
5 |
tttaagaatatggacacaaattgnnnnnnn-tattattgcaccttcaccttagctagctagtgactaaatttggaatttacgnnnnnnnnnt---cttag |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||| |
|
|
| T |
44580489 |
tttaagaatatggacacaaattgaaaaaaaatattattgcaccttcaccttagctagctagtgactaaatttggaatctacgaaaaaaaaataatcttag |
44580390 |
T |
 |
| Q |
101 |
aagatgctt--------aggtatctgggcaaattggtatatcaaattaatttgaaaccactttcacacaaacatatagtgacatgtaatcttcttctcta |
192 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
44580389 |
aagatgctttattgcttaggtatctgggcaaattggtatatcaaattaatttgaaaccactttcacgcagacatatagtgacatgtaatcttcttctcta |
44580290 |
T |
 |
| Q |
193 |
aggaacacggc |
203 |
Q |
| |
|
||||||||||| |
|
|
| T |
44580289 |
aggaacacggc |
44580279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University