View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_86 (Length: 238)
Name: NF16751_low_86
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_86 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 13285528 - 13285759
Alignment:
| Q |
1 |
cagtgtacgtttcattcacctttggattagctacacttcttttcagtcatttttaggaacaggaaaaataaaagtaaaagcatagaggtgac-------- |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13285528 |
cagtgtacgtttcattcacctttggattagctacacttcttttcagtcatttttaggaacaggaaaaataaaagtaaaagcatagaggtgacagcttaga |
13285627 |
T |
 |
| Q |
93 |
--------ataactctattgaatttgaatctagtacatg-nnnnnnnnataagaaacaagataaaatttactaggacataggatgtttgtcccacgtgtg |
183 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13285628 |
attacattacaactctattgaatttgaatctagtacatgttttttttgataagaaagaagataaaatttactaggacataggatgtttgtcccacgtgtg |
13285727 |
T |
 |
| Q |
184 |
acggttggaattggaattagaagaaggtatgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13285728 |
acggttggaattggaattagaagaaggtatgt |
13285759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University