View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_89 (Length: 237)
Name: NF16751_low_89
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_89 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 45389757 - 45389977
Alignment:
| Q |
1 |
taacagtaaacaggcttacttgacatagttttgtcttgtgtaacaggggtcagtacagaacctggataaaaactgcaccagtgccatgtcttcttatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45389757 |
taacagtaaacaggcttacttgacatagttttgtcttgtgtaacaggggtcagtacagaacctgaataaaaactgcaccagtgcaatgtcttcttatcca |
45389856 |
T |
|
| Q |
101 |
gacctggtatgtttccatgaactttcatcattagctcaggaagattgtacaagattctgacatatttcatgtttcatgcagtgcttctttccacaatatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45389857 |
gacctggtatgtttccatgaactttcatcattagctcaggaagattgtacaagattctgacatatttcatgtttcatgcagtgcttctttccacaatatg |
45389956 |
T |
|
| Q |
201 |
tgttgaaatatatatcaacac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45389957 |
tgttgaaatatatatcaacac |
45389977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 2 - 221
Target Start/End: Original strand, 45374600 - 45374819
Alignment:
| Q |
2 |
aacagtaaacaggcttacttgacatagttttgtcttgtgtaacaggggtcagtacagaacctggataaaaactgcaccagtgccatgtcttcttatccag |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||| ||| |||||||||||| |
|
|
| T |
45374600 |
aacagtaaacgggcttacttgacatagttttgtcttgtgtaacaggggtcagtacagaacttgaataaaaattgcaccagtgcgatgccttcttatccag |
45374699 |
T |
|
| Q |
102 |
acctggtatgtttccatgaactttcatcattagctcaggaagattgtacaagattctgacatatttcatgtttcatgcagtgcttctttccacaatatgt |
201 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45374700 |
acctagtatgtttccatgaactttcatcattagctcaggatgattgtacaagattctgacatatttcgtgtttcatgcagtgcttctttccacaatatgt |
45374799 |
T |
|
| Q |
202 |
gttgaaatatatatcaacac |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45374800 |
gttgaaatatatatcaacac |
45374819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University