View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16751_low_90 (Length: 236)

Name: NF16751_low_90
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16751_low_90
NF16751_low_90
[»] chr3 (2 HSPs)
chr3 (107-221)||(31555047-31555161)
chr3 (16-70)||(31555194-31555251)


Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 107 - 221
Target Start/End: Complemental strand, 31555161 - 31555047
Alignment:
107 gttcctacaaattaataattttagggtcatacgatagctcttagaaaataaataatcttaagacatttgttaaaaaataaaataaacgatacaagtaagt 206  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31555161 gttcctacaaattaataattttaggatcatacgatagctcttagaaaataaataatcttaagacatttgttaaaaaataaaataaacgatacaagtaagt 31555062  T
207 ttcacgtgaaaaagt 221  Q
    |||||||||||||||    
31555061 ttcacgtgaaaaagt 31555047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 70
Target Start/End: Complemental strand, 31555251 - 31555194
Alignment:
16 aattctgagggagcctttttactgatactctttct---ctattttgtaaagtaaattg 70  Q
    ||||||| ||||||||||||||| |||||||||||   ||||||||||||||||||||    
31555251 aattctgggggagcctttttacttatactctttctctactattttgtaaagtaaattg 31555194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University