View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_90 (Length: 236)
Name: NF16751_low_90
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_90 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 107 - 221
Target Start/End: Complemental strand, 31555161 - 31555047
Alignment:
| Q |
107 |
gttcctacaaattaataattttagggtcatacgatagctcttagaaaataaataatcttaagacatttgttaaaaaataaaataaacgatacaagtaagt |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31555161 |
gttcctacaaattaataattttaggatcatacgatagctcttagaaaataaataatcttaagacatttgttaaaaaataaaataaacgatacaagtaagt |
31555062 |
T |
 |
| Q |
207 |
ttcacgtgaaaaagt |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31555061 |
ttcacgtgaaaaagt |
31555047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 70
Target Start/End: Complemental strand, 31555251 - 31555194
Alignment:
| Q |
16 |
aattctgagggagcctttttactgatactctttct---ctattttgtaaagtaaattg |
70 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
31555251 |
aattctgggggagcctttttacttatactctttctctactattttgtaaagtaaattg |
31555194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University