View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16751_low_92 (Length: 235)
Name: NF16751_low_92
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16751_low_92 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 24845679 - 24845840
Alignment:
| Q |
1 |
aaaccaaaacggcacgctacataaggggaccataggttcaattatgaacaagaaatctggcttataggtgttcatcaaatgaatcaaatcagtctgagaa |
100 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| ||||||||| ||| ||||||||||||| |
|
|
| T |
24845679 |
aaactaaaatggcacgctacataaggggaccataggttcagttatgaacaa-aaatctggcttataggtgtttatcaaatgactcagatcagtctgagaa |
24845777 |
T |
|
| Q |
101 |
atgtgaatatccagtattcatgttgaaatagttttagaggttacataattttgaattacttgg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24845778 |
atgtgaatatccagtattcatgttgaaatagttttagaggttacataattttgaatttcttgg |
24845840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University