View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16753_high_11 (Length: 263)
Name: NF16753_high_11
Description: NF16753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16753_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 32 - 247
Target Start/End: Complemental strand, 51108944 - 51108729
Alignment:
| Q |
32 |
caacactatcaaaattgtcatctttgctattgggaatatgttccatggtgattttggtattgtgacaatctgcgtctcttggttttattcatgtcgcgca |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51108944 |
caacactatcaaaattgtcatctttgctattgggaatatgttgcatggtgattttggtattgtgacaatctgcgtctcttggttttattcatgtcgcgca |
51108845 |
T |
|
| Q |
132 |
ttttgtgtttgtgccttcagtaagcttgagcattatccttcacgttatgtgtttggtagctttgctatgtattggtggtgttggttgatgatgtttttct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51108844 |
ttttgtgtttgtgccttcagtaagcttgagcattatccttcacgttatgtgtttggtagctttgctatgtattggtggtgttggttgatgatgtttttct |
51108745 |
T |
|
| Q |
232 |
gtgttttctctttcat |
247 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51108744 |
gtgttttctctttcat |
51108729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University