View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16753_high_2 (Length: 428)
Name: NF16753_high_2
Description: NF16753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16753_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 410
Target Start/End: Original strand, 35837025 - 35837437
Alignment:
| Q |
1 |
attggactaactttgacagctcagtcaatgctgtttcctttggctttgtagctactgctattctcatttccatgttcttagtcatggctatttttgagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35837025 |
attggactaactttgacagctcagtcaatgctgtttcctttggctttgtagctactgctattctcatttccatgttcttagtcatggctatttttgagag |
35837124 |
T |
 |
| Q |
101 |
atttcttagacccatttctccacctatgtccccgcctggtcgccggagtcagcgtgatgttgagtctcagatgagttcatatggcaagctctctcaccca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35837125 |
atttcttagacccatttctccacctatgtcgccgcctggtcgccggagtcagcgtgatgttgagtctcagatgagttcatatggcaagctctctcaccca |
35837224 |
T |
 |
| Q |
201 |
tcaccaaaagtaagtataatcactaaatattattgtatttttcttctttaatttggttccagtaattaaacaagcccttcaa-tttttagcattaaaact |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35837225 |
tcaccaaaagtaagtataatcactaaatattattgtttttttcttcttttatttggttccagtaattaaacaagcccttcaattttttagcattaaaact |
35837324 |
T |
 |
| Q |
300 |
ggtttctttg-nnnnnnnagtttaactgacaatgtggtactgttggnnnnnnnctctccacatttgg-ttagttggttgttttgatttctgaataagtga |
397 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35837325 |
ggtttctttgttttttttagtttaactgacaatgtggtactgttggtttttttctctccacatttggtttagttggttgttttgatttctgaataagtga |
35837424 |
T |
 |
| Q |
398 |
ttatcgtttaact |
410 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
35837425 |
ttatcttttaact |
35837437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University