View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16753_low_11 (Length: 284)
Name: NF16753_low_11
Description: NF16753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16753_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 14 - 260
Target Start/End: Complemental strand, 3613169 - 3612923
Alignment:
| Q |
14 |
acatcatcacacaaatcagcagagataacattgttagcaatcccaacttgagcagcctggcgctcttttgctaatgcatatacatgtcgtgcctcatcag |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3613169 |
acatcatcacacaaatcagcagagataccattgttagcaatcccaacttgagcagcctggcgctcttttgcaaatgcatatacatgtcgtgcctcatcag |
3613070 |
T |
 |
| Q |
114 |
tagctaatatttggtcaagaaaatttgcagattcatgcttagtattggccattgtatcgataaaaaggagggtaaaaaaggaaaatattatttgtttttg |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3613069 |
tagctagtatttggtcaagaaaatttgcagattcatgcttagtattggccattgtatcgataaaaaggagggtaaaaaaggaaaatattatttgtttttg |
3612970 |
T |
 |
| Q |
214 |
gctttatcacttttggaggatttgctggaagactagtgcaagtgcaa |
260 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3612969 |
gctttatcacttttggaggatttgatggaagactagtgcaagtgcaa |
3612923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 190 - 254
Target Start/End: Complemental strand, 14757037 - 14756973
Alignment:
| Q |
190 |
aaaggaaaatattatttgtttttggctttatcacttttggaggatttgctggaagactagtgcaa |
254 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
14757037 |
aaaggaaaatataatttgtttttggctttatcacttttggaggattggatggaagactggtgcaa |
14756973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University