View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16754_high_49 (Length: 256)
Name: NF16754_high_49
Description: NF16754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16754_high_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 1385520 - 1385639
Alignment:
| Q |
1 |
ttattttggtcttttaatttgtgagacacaattgctatagtatctaattaaccaaaatattacaaaaatacctgcaaaatatgtctctcataatattaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1385520 |
ttattttggtcttttaatttgtgagacacaattgctatagtatctaattaaccaaaatattacaaaaatacctgcaaaatatgtctctcataatattaac |
1385619 |
T |
|
| Q |
101 |
caatttaggcttctcaattg |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1385620 |
caatttaggcttctcaattg |
1385639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 1385657 - 1385697
Alignment:
| Q |
175 |
tttaaacacatgtgcaccatatctacatcttgagagataaa |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1385657 |
tttaaacacctgtgcaccatatctacatcttgagagataaa |
1385697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University