View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16754_low_41 (Length: 310)
Name: NF16754_low_41
Description: NF16754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16754_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 51792889 - 51792627
Alignment:
| Q |
1 |
ataagactcgtacaacatgcatatttaattgcttgattcattaagattttgtaggtatatatgcttttacaaaaatataaataatttatttcataaaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51792889 |
ataagactcgtacaacatgcatatttaattgcttgattcattaagattttgtaggtatatatgcttttacaaaaatataaataatttatttgataaaaga |
51792790 |
T |
|
| Q |
101 |
agaataaaattattaaggataac-nnnnnnnnnagaagtattaaggagaac----ttgttgatatatacatgcagnnnnnnnnnacgactaattgatacc |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51792789 |
agaataaaattattaaggataacttttttttttagaagtattaaggagaacttgtttgttgatatatacatgcagtttttttttacgactaattgatacc |
51792690 |
T |
|
| Q |
196 |
agcagttctgttaacacgactttaaatacnnnnnnnttaacatgccattattcgtctattaggt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51792689 |
tgcagttctgttaacacgactttaaatac-aaaaaattaacatgccattattcgtctattaggt |
51792627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University